Регион:

Добро пожаловать на сайт группы компаний Альгимед.
Пожалуйста, выберите ваш регион

Заказ 0
  • На данный момент у Вас ни одной заявки. Пожалуйста, перейдите в каталог, чтобы выбрать товар.

Связаться с нами
Более 12565 позиций в каталоге.   Свыше 11 100 довольных клиентов!
Главная/Каталог продукции/Химические реактивы и наборы реагентов/Молекулярная биология/ПЦР

ПЦР

Подбор параметров
Бренды
Предназначание продукции
Наличие
АБВГДЕЁЖЗИЙКЛМНОПРСТУФХЦЧШЩЪЫЬЭЮЯ
ABCDEFGHIJKLMNOPQRSTUVWXYZ
0123456789
Артикул Название продукции Краткое описание  
COV019 Стандарт SARS-CoV-2 , положительный Стандарт SARS-CoV-2 содержит синтетические РНК-транскрипты пяти мишеней гена SARS-CoV-2 и ДНК генома человека. 5 виал, 0.3 мл, хранить при -20°C Заявка под заказ
COV000 Стандарт SARS-CoV-2, отрицательный Отрицательный стандарт SARS-CoV-2 содержит геномную ДНК в количестве 75 000 копий / мл, сформированную в синтетической матрице. 5 виал, 0.3 мл, хранить при -20°C Заявка под заказ
COVID-19-PCR-AUS-C SARS-CoV-2 Real-time RT-PCR, 48 тестов Чувствительность – 20 копий/мл из 400 мкл материала. Каждый набор содержит 48 тестов. Срок годности всех реагентов при правильном хранении составляет 12 месяцев. Хранить анализы при температуре от -25℃ до -15℃. Заявка под заказ
M6101 ДНКаза I RQ1, свободная от РНКаз, 1000 ед., 1 ед./мкл, Promega, M6101 ДНКаза I RQ1, свободная от РНКаз, 1000 ед., 1 ед./мкл, Promega, M6101 Заявка под заказ
D-5580 Набор реагентов «РеалБест РНК SARS-CoV-2» Набор реагентов «РеалБест РНК SARS-CoV-2» для выявления РНК коронавируса SARS-CoV-2 методом ОТ-ПЦР в режиме реального времени. Форма выпуска: готовая лиофилизированная реакционная смесь. Количество определений: 96 (включая два контрольных образца).
Данный набор доступен только на территории РБ.
Заявка под заказ
A1223 Набор реагентов PureYield™ Plasmid Miniprep System, 100 реакций, Promega, A1223 Набор реагентов PureYield™ Plasmid Miniprep System, 100 реакций, Promega, A1223 Заявка под заказ
Z3741 Набор реагентов PureYield™ RNA Midiprep System, 50 реакций, Promega, Z3741 Набор реагентов PureYield™ RNA Midiprep System, 50 реакций, Promega, Z3741 Заявка под заказ
E4870 Набор реагентов QuantiFluor® ONE dsDNA System, 500 реакций, Promega, E4870 Набор реагентов QuantiFluor® ONE dsDNA System, 500 реакций, Promega, E4870 Заявка под заказ
A5081 Набор реагентов ReliaPrep™ Blood gDNA Miniprep System, 100 реакций, Promega, A5081 Набор реагентов ReliaPrep™ Blood gDNA Miniprep System, 100 реакций, Promega, A5081 Заявка под заказ
miR-375-3p Набор реагентов для проведения количественного анализа молекулы микроРНК hsa-miR-375-3p (MIMAT0000728) Набор реагентов предназначен для проведения количественного анализа определенной молекулы микроРНК miR-375-3p. (Последовательность: UUUGUUCGUUCGGCUCGCGUGA) Заявка под заказ
AL-SARS2-48 ПЦР-набор «ALSENSE»

Набор реагентов для качественного выявления SARS-СоV-2 методом ОТ-ПЦР в реальном времени «ALSENSE-SARS-CoV-2-RT-qPCR» предназначен для выявления РНК коронавируса 2019-nCoV методом одностадийной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени (далее ОТ-ПЦР-РВ) в препаратах нуклеиновых кислот (НК), выделенных из клинических образцов (назальный секрет, мазок из носоглотки, мазок ротоглотки, мокрота, эндотрахеальный аспират, бронхоальвеолярный смыв, осадок мочи, ректальный мазок, плазма, сыворотка крови человека), далее по тексту – набор. Набор детектирует следующие гены: 3 локуса гена orf1ab коронавируса 2019-nCoV и гены S, E и N коронавируса 2019-nCoV.

Регистрационном удостоверении на МТ и МН № ИМ-7.109002

Заявка под заказ
E2670 Реагент QuantiFluor dsDNA System, 2000 реакций, Promega, E2670 Набор реагентов QuantiFluor dsDNA System, 200 реакций, Promega, E2670 Заявка под заказ
1863053 Реагент для верификации для метода ПЦР DD FLUIDIC VERIF RGNTS, 1863053, Bio-Rad Laboratories Реагент для верификации для метода ПЦР DD FLUIDIC VERIF RGNTS, 1863053, Bio-Rad Laboratories Заявка под заказ
1863053K Реагент для верификации для метода ПЦР DD FLUIDIC VERIF RGNTS, 1863053, Bio-Rad Laboratories Заявка под заказ
1863005 Реагент для ПЦР Droplet generation oil, 10 х7мл, 1863005, Bio-Rad Laboratories Реагент для ПЦР Droplet generation oil, 10 х7мл, 1863005, Bio-Rad Laboratories Заявка под заказ
1863005 Реагент для ПЦР Droplet generation oil, 10 х7мл, 1863005, Bio-Rad Laboratories Заявка под заказ
1863004 Реагент для ПЦР Droplet reader oil, 2 х1л, 1863004, Bio-Rad Laboratories Реагент для ПЦР Droplet reader oil, 2 х1л, 1863004, Bio-Rad Laboratories Заявка под заказ
1863004 Реагент для ПЦР Droplet reader oil, 2 х1л, 1863004, Bio-Rad Laboratories Заявка под заказ
C-8814 РеалБест Гемолитик № РЗН 2015/2861, Набор реагентов для предварительной обработки цельной периферической крови. Заявка под заказ
C-8893 РеалБест ДельтаМаг ВГВ/ВГС/ВИЧ (вариант 0,25-8) № РЗН 2017/6047, Набор реагентов для одновременного выделения ДНК ВГВ, РНК ВГС и РНК ВИЧ из сыворотки (плазмы) крови. Выделение из 250 мкл сыворотки (плазмы) крови. Заявка под заказ